Review



algorithms zen microscopy software carl zeiss imaging blue  (Carl Zeiss)


Bioz Verified Symbol Carl Zeiss is a verified supplier
Bioz Manufacturer Symbol Carl Zeiss manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    Carl Zeiss algorithms zen microscopy software carl zeiss imaging blue
    Algorithms Zen Microscopy Software Carl Zeiss Imaging Blue, supplied by Carl Zeiss, used in various techniques. Bioz Stars score: 96/100, based on 11705 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+zen+microscopy+software+carl+zeiss+imaging+blue/pm39423123-82-124-128
    Average 96 stars, based on 11705 article reviews
    algorithms zen microscopy software carl zeiss imaging blue - by Bioz Stars, 2026-09
    96/100 stars

    Images

    Related Articles

    Real-time Polymerase Chain Reaction:

    Article Title: Protocol for constructing and characterizing recombinant vectored vaccines for rabies virus.
    Article Snippet: .. GTCCTGGATTCTATCAGCCACTTC Invitrogen, Thermo Fisher Scientific N/A VSV down: TGGGACAACTCCAGTGAA AAGTTCTTCTCCTTTACTCAT Invitrogen, Thermo Fisher Scientific N/A qPCR-VSV N-F: TGATCGACTTTGGATTGTCTTCTAA Invitrogen, Thermo Fisher Scientific N/A qPCR-VSV-N R: TCTGGTGGATCTGAGCAGAAGAG Invitrogen, Thermo Fisher Scientific N/A qPCR-VSV-N probe: FAM-ATATTCTTCCG TCAAAAACCCTGCCTTCCA-TAM Invitrogen, Thermo Fisher Scientific N/A Random hexamers (100 mL) Invitrogen, Thermo Fisher Scientific Cat# N8080127 (Continued on next page) STAR Protocols 5, 103392, December 20, 2024 7 Continued REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant DNA pBS-P-VT Kerafast Cat# EH1014 pBS-L-VT Kerafast Cat# EH1015 pBS-N-VT Kerafast Cat# EH1013 pBS-G-VT Kerafast Cat# EH1016 VSV-dG-GFP-2.6 Kerafast Cat# EH1026 pCAGG-GFP A gift from Luis Martinez-Sobrido, Texas Biomedical Research Institute, USA N/A pCITE-GFP A gift from Luis Martinez-Sobrido, Texas Biomedical Research Institute, USA N/A pCAGG-RV-G-HA-COOH This study N/A pVSV-dG-RV-G-GFP This study N/A Software and algorithms ZEN Microscopy software Carl Zeiss Imaging (blue) 3.6 GraphPad prism GraphPad Software, Inc. .. Version 9 CFX Maestro Software Bio-Rad Version 3.1 Other 0.2 mL PCR tubes Applied Biosystems N/A 0.45-, 0.2 mm filter Starlab Cat# E4780-1456 1.5 mL microcentrifuge tubes Merck Cat# HS4323 6-Well cell culture plate Greiner Cat# 657160 Autoclave Astell N/A Bacterial incubator 37 C Sanyo N/A Blotting papers Bio-Rad Cat# 170396 Cell culture CO2 incubator Panasonic N/A Cell culture flask with filter cap 75 cm2 Greiner Cat# 658175 Centrifuge 5424 R Eppendorf N/A Centrifuge Allegra X-30R Beckman Coulter N/A Centrifuge tube 50 mL Greiner Cat# 227261 CFX96 Real-Time system Bio-Rad N/A ChemiDoc MP imaging system Bio-Rad N/A Cryovials, 1.8 mL Corning N/A CytoFLEX flow cytometer Beckman Coulter N/A Latex gloves Fisher Scientific N/A Nano-Drop 2000c spectrophotometer Thermo Scientific Cat#ND2000CLAPTOP Nunc Thermanox coverslips Thermo Scientific Cat# 174942 Parafilm Starlab Cat# 13080 Petri dishes for bacteria, 100 mm Sarstedt N/A Pipette tips 1 mL, 200 mL, 10 mL Starlab N/A Pipettes 200 mL–1 mL, 20–200 mL, and 0.5 mL–1 mL Gilson N/A PTC-200 Peltier thermal cycler Universal Resource Trading Ltd. N/A PVDF membrane Thermo Scientific Cat# 88518 qPCR tube 0.1 mL Bio-Rad N/A SDS-PAGE system Bio-Rad N/A Stripette, 5, 10, 25 mL Corning N/A Trans-blot turbo membrane blotter Bio-Rad N/A UV transilluminator Syngene N/A Vortex SLS Lab Basics N/A ZOE fluorescent cell imager Bio-Rad N/A 8 STAR Protocols 5, 103392, December 20, 2024

    Recombinant:

    Article Title: Protocol for constructing and characterizing recombinant vectored vaccines for rabies virus.
    Article Snippet: .. GTCCTGGATTCTATCAGCCACTTC Invitrogen, Thermo Fisher Scientific N/A VSV down: TGGGACAACTCCAGTGAA AAGTTCTTCTCCTTTACTCAT Invitrogen, Thermo Fisher Scientific N/A qPCR-VSV N-F: TGATCGACTTTGGATTGTCTTCTAA Invitrogen, Thermo Fisher Scientific N/A qPCR-VSV-N R: TCTGGTGGATCTGAGCAGAAGAG Invitrogen, Thermo Fisher Scientific N/A qPCR-VSV-N probe: FAM-ATATTCTTCCG TCAAAAACCCTGCCTTCCA-TAM Invitrogen, Thermo Fisher Scientific N/A Random hexamers (100 mL) Invitrogen, Thermo Fisher Scientific Cat# N8080127 (Continued on next page) STAR Protocols 5, 103392, December 20, 2024 7 Continued REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant DNA pBS-P-VT Kerafast Cat# EH1014 pBS-L-VT Kerafast Cat# EH1015 pBS-N-VT Kerafast Cat# EH1013 pBS-G-VT Kerafast Cat# EH1016 VSV-dG-GFP-2.6 Kerafast Cat# EH1026 pCAGG-GFP A gift from Luis Martinez-Sobrido, Texas Biomedical Research Institute, USA N/A pCITE-GFP A gift from Luis Martinez-Sobrido, Texas Biomedical Research Institute, USA N/A pCAGG-RV-G-HA-COOH This study N/A pVSV-dG-RV-G-GFP This study N/A Software and algorithms ZEN Microscopy software Carl Zeiss Imaging (blue) 3.6 GraphPad prism GraphPad Software, Inc. .. Version 9 CFX Maestro Software Bio-Rad Version 3.1 Other 0.2 mL PCR tubes Applied Biosystems N/A 0.45-, 0.2 mm filter Starlab Cat# E4780-1456 1.5 mL microcentrifuge tubes Merck Cat# HS4323 6-Well cell culture plate Greiner Cat# 657160 Autoclave Astell N/A Bacterial incubator 37 C Sanyo N/A Blotting papers Bio-Rad Cat# 170396 Cell culture CO2 incubator Panasonic N/A Cell culture flask with filter cap 75 cm2 Greiner Cat# 658175 Centrifuge 5424 R Eppendorf N/A Centrifuge Allegra X-30R Beckman Coulter N/A Centrifuge tube 50 mL Greiner Cat# 227261 CFX96 Real-Time system Bio-Rad N/A ChemiDoc MP imaging system Bio-Rad N/A Cryovials, 1.8 mL Corning N/A CytoFLEX flow cytometer Beckman Coulter N/A Latex gloves Fisher Scientific N/A Nano-Drop 2000c spectrophotometer Thermo Scientific Cat#ND2000CLAPTOP Nunc Thermanox coverslips Thermo Scientific Cat# 174942 Parafilm Starlab Cat# 13080 Petri dishes for bacteria, 100 mm Sarstedt N/A Pipette tips 1 mL, 200 mL, 10 mL Starlab N/A Pipettes 200 mL–1 mL, 20–200 mL, and 0.5 mL–1 mL Gilson N/A PTC-200 Peltier thermal cycler Universal Resource Trading Ltd. N/A PVDF membrane Thermo Scientific Cat# 88518 qPCR tube 0.1 mL Bio-Rad N/A SDS-PAGE system Bio-Rad N/A Stripette, 5, 10, 25 mL Corning N/A Trans-blot turbo membrane blotter Bio-Rad N/A UV transilluminator Syngene N/A Vortex SLS Lab Basics N/A ZOE fluorescent cell imager Bio-Rad N/A 8 STAR Protocols 5, 103392, December 20, 2024

    Software:

    Article Title: Protocol for constructing and characterizing recombinant vectored vaccines for rabies virus.
    Article Snippet: .. GTCCTGGATTCTATCAGCCACTTC Invitrogen, Thermo Fisher Scientific N/A VSV down: TGGGACAACTCCAGTGAA AAGTTCTTCTCCTTTACTCAT Invitrogen, Thermo Fisher Scientific N/A qPCR-VSV N-F: TGATCGACTTTGGATTGTCTTCTAA Invitrogen, Thermo Fisher Scientific N/A qPCR-VSV-N R: TCTGGTGGATCTGAGCAGAAGAG Invitrogen, Thermo Fisher Scientific N/A qPCR-VSV-N probe: FAM-ATATTCTTCCG TCAAAAACCCTGCCTTCCA-TAM Invitrogen, Thermo Fisher Scientific N/A Random hexamers (100 mL) Invitrogen, Thermo Fisher Scientific Cat# N8080127 (Continued on next page) STAR Protocols 5, 103392, December 20, 2024 7 Continued REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant DNA pBS-P-VT Kerafast Cat# EH1014 pBS-L-VT Kerafast Cat# EH1015 pBS-N-VT Kerafast Cat# EH1013 pBS-G-VT Kerafast Cat# EH1016 VSV-dG-GFP-2.6 Kerafast Cat# EH1026 pCAGG-GFP A gift from Luis Martinez-Sobrido, Texas Biomedical Research Institute, USA N/A pCITE-GFP A gift from Luis Martinez-Sobrido, Texas Biomedical Research Institute, USA N/A pCAGG-RV-G-HA-COOH This study N/A pVSV-dG-RV-G-GFP This study N/A Software and algorithms ZEN Microscopy software Carl Zeiss Imaging (blue) 3.6 GraphPad prism GraphPad Software, Inc. .. Version 9 CFX Maestro Software Bio-Rad Version 3.1 Other 0.2 mL PCR tubes Applied Biosystems N/A 0.45-, 0.2 mm filter Starlab Cat# E4780-1456 1.5 mL microcentrifuge tubes Merck Cat# HS4323 6-Well cell culture plate Greiner Cat# 657160 Autoclave Astell N/A Bacterial incubator 37 C Sanyo N/A Blotting papers Bio-Rad Cat# 170396 Cell culture CO2 incubator Panasonic N/A Cell culture flask with filter cap 75 cm2 Greiner Cat# 658175 Centrifuge 5424 R Eppendorf N/A Centrifuge Allegra X-30R Beckman Coulter N/A Centrifuge tube 50 mL Greiner Cat# 227261 CFX96 Real-Time system Bio-Rad N/A ChemiDoc MP imaging system Bio-Rad N/A Cryovials, 1.8 mL Corning N/A CytoFLEX flow cytometer Beckman Coulter N/A Latex gloves Fisher Scientific N/A Nano-Drop 2000c spectrophotometer Thermo Scientific Cat#ND2000CLAPTOP Nunc Thermanox coverslips Thermo Scientific Cat# 174942 Parafilm Starlab Cat# 13080 Petri dishes for bacteria, 100 mm Sarstedt N/A Pipette tips 1 mL, 200 mL, 10 mL Starlab N/A Pipettes 200 mL–1 mL, 20–200 mL, and 0.5 mL–1 mL Gilson N/A PTC-200 Peltier thermal cycler Universal Resource Trading Ltd. N/A PVDF membrane Thermo Scientific Cat# 88518 qPCR tube 0.1 mL Bio-Rad N/A SDS-PAGE system Bio-Rad N/A Stripette, 5, 10, 25 mL Corning N/A Trans-blot turbo membrane blotter Bio-Rad N/A UV transilluminator Syngene N/A Vortex SLS Lab Basics N/A ZOE fluorescent cell imager Bio-Rad N/A 8 STAR Protocols 5, 103392, December 20, 2024

    Microscopy:

    Article Title: Protocol for constructing and characterizing recombinant vectored vaccines for rabies virus.
    Article Snippet: .. GTCCTGGATTCTATCAGCCACTTC Invitrogen, Thermo Fisher Scientific N/A VSV down: TGGGACAACTCCAGTGAA AAGTTCTTCTCCTTTACTCAT Invitrogen, Thermo Fisher Scientific N/A qPCR-VSV N-F: TGATCGACTTTGGATTGTCTTCTAA Invitrogen, Thermo Fisher Scientific N/A qPCR-VSV-N R: TCTGGTGGATCTGAGCAGAAGAG Invitrogen, Thermo Fisher Scientific N/A qPCR-VSV-N probe: FAM-ATATTCTTCCG TCAAAAACCCTGCCTTCCA-TAM Invitrogen, Thermo Fisher Scientific N/A Random hexamers (100 mL) Invitrogen, Thermo Fisher Scientific Cat# N8080127 (Continued on next page) STAR Protocols 5, 103392, December 20, 2024 7 Continued REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant DNA pBS-P-VT Kerafast Cat# EH1014 pBS-L-VT Kerafast Cat# EH1015 pBS-N-VT Kerafast Cat# EH1013 pBS-G-VT Kerafast Cat# EH1016 VSV-dG-GFP-2.6 Kerafast Cat# EH1026 pCAGG-GFP A gift from Luis Martinez-Sobrido, Texas Biomedical Research Institute, USA N/A pCITE-GFP A gift from Luis Martinez-Sobrido, Texas Biomedical Research Institute, USA N/A pCAGG-RV-G-HA-COOH This study N/A pVSV-dG-RV-G-GFP This study N/A Software and algorithms ZEN Microscopy software Carl Zeiss Imaging (blue) 3.6 GraphPad prism GraphPad Software, Inc. .. Version 9 CFX Maestro Software Bio-Rad Version 3.1 Other 0.2 mL PCR tubes Applied Biosystems N/A 0.45-, 0.2 mm filter Starlab Cat# E4780-1456 1.5 mL microcentrifuge tubes Merck Cat# HS4323 6-Well cell culture plate Greiner Cat# 657160 Autoclave Astell N/A Bacterial incubator 37 C Sanyo N/A Blotting papers Bio-Rad Cat# 170396 Cell culture CO2 incubator Panasonic N/A Cell culture flask with filter cap 75 cm2 Greiner Cat# 658175 Centrifuge 5424 R Eppendorf N/A Centrifuge Allegra X-30R Beckman Coulter N/A Centrifuge tube 50 mL Greiner Cat# 227261 CFX96 Real-Time system Bio-Rad N/A ChemiDoc MP imaging system Bio-Rad N/A Cryovials, 1.8 mL Corning N/A CytoFLEX flow cytometer Beckman Coulter N/A Latex gloves Fisher Scientific N/A Nano-Drop 2000c spectrophotometer Thermo Scientific Cat#ND2000CLAPTOP Nunc Thermanox coverslips Thermo Scientific Cat# 174942 Parafilm Starlab Cat# 13080 Petri dishes for bacteria, 100 mm Sarstedt N/A Pipette tips 1 mL, 200 mL, 10 mL Starlab N/A Pipettes 200 mL–1 mL, 20–200 mL, and 0.5 mL–1 mL Gilson N/A PTC-200 Peltier thermal cycler Universal Resource Trading Ltd. N/A PVDF membrane Thermo Scientific Cat# 88518 qPCR tube 0.1 mL Bio-Rad N/A SDS-PAGE system Bio-Rad N/A Stripette, 5, 10, 25 mL Corning N/A Trans-blot turbo membrane blotter Bio-Rad N/A UV transilluminator Syngene N/A Vortex SLS Lab Basics N/A ZOE fluorescent cell imager Bio-Rad N/A 8 STAR Protocols 5, 103392, December 20, 2024

    Imaging:

    Article Title: Protocol for constructing and characterizing recombinant vectored vaccines for rabies virus.
    Article Snippet: .. GTCCTGGATTCTATCAGCCACTTC Invitrogen, Thermo Fisher Scientific N/A VSV down: TGGGACAACTCCAGTGAA AAGTTCTTCTCCTTTACTCAT Invitrogen, Thermo Fisher Scientific N/A qPCR-VSV N-F: TGATCGACTTTGGATTGTCTTCTAA Invitrogen, Thermo Fisher Scientific N/A qPCR-VSV-N R: TCTGGTGGATCTGAGCAGAAGAG Invitrogen, Thermo Fisher Scientific N/A qPCR-VSV-N probe: FAM-ATATTCTTCCG TCAAAAACCCTGCCTTCCA-TAM Invitrogen, Thermo Fisher Scientific N/A Random hexamers (100 mL) Invitrogen, Thermo Fisher Scientific Cat# N8080127 (Continued on next page) STAR Protocols 5, 103392, December 20, 2024 7 Continued REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant DNA pBS-P-VT Kerafast Cat# EH1014 pBS-L-VT Kerafast Cat# EH1015 pBS-N-VT Kerafast Cat# EH1013 pBS-G-VT Kerafast Cat# EH1016 VSV-dG-GFP-2.6 Kerafast Cat# EH1026 pCAGG-GFP A gift from Luis Martinez-Sobrido, Texas Biomedical Research Institute, USA N/A pCITE-GFP A gift from Luis Martinez-Sobrido, Texas Biomedical Research Institute, USA N/A pCAGG-RV-G-HA-COOH This study N/A pVSV-dG-RV-G-GFP This study N/A Software and algorithms ZEN Microscopy software Carl Zeiss Imaging (blue) 3.6 GraphPad prism GraphPad Software, Inc. .. Version 9 CFX Maestro Software Bio-Rad Version 3.1 Other 0.2 mL PCR tubes Applied Biosystems N/A 0.45-, 0.2 mm filter Starlab Cat# E4780-1456 1.5 mL microcentrifuge tubes Merck Cat# HS4323 6-Well cell culture plate Greiner Cat# 657160 Autoclave Astell N/A Bacterial incubator 37 C Sanyo N/A Blotting papers Bio-Rad Cat# 170396 Cell culture CO2 incubator Panasonic N/A Cell culture flask with filter cap 75 cm2 Greiner Cat# 658175 Centrifuge 5424 R Eppendorf N/A Centrifuge Allegra X-30R Beckman Coulter N/A Centrifuge tube 50 mL Greiner Cat# 227261 CFX96 Real-Time system Bio-Rad N/A ChemiDoc MP imaging system Bio-Rad N/A Cryovials, 1.8 mL Corning N/A CytoFLEX flow cytometer Beckman Coulter N/A Latex gloves Fisher Scientific N/A Nano-Drop 2000c spectrophotometer Thermo Scientific Cat#ND2000CLAPTOP Nunc Thermanox coverslips Thermo Scientific Cat# 174942 Parafilm Starlab Cat# 13080 Petri dishes for bacteria, 100 mm Sarstedt N/A Pipette tips 1 mL, 200 mL, 10 mL Starlab N/A Pipettes 200 mL–1 mL, 20–200 mL, and 0.5 mL–1 mL Gilson N/A PTC-200 Peltier thermal cycler Universal Resource Trading Ltd. N/A PVDF membrane Thermo Scientific Cat# 88518 qPCR tube 0.1 mL Bio-Rad N/A SDS-PAGE system Bio-Rad N/A Stripette, 5, 10, 25 mL Corning N/A Trans-blot turbo membrane blotter Bio-Rad N/A UV transilluminator Syngene N/A Vortex SLS Lab Basics N/A ZOE fluorescent cell imager Bio-Rad N/A 8 STAR Protocols 5, 103392, December 20, 2024



    Similar Products

    algorithms zen microscopy software carl zeiss imaging blue  (Carl Zeiss)
    96
    Carl Zeiss algorithms zen microscopy software carl zeiss imaging blue
    Algorithms Zen Microscopy Software Carl Zeiss Imaging Blue, supplied by Carl Zeiss, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+zen+microscopy+software+carl+zeiss+imaging+blue/pm39423123-82-124-128
    Average 96 stars, based on 1 article reviews
    algorithms zen microscopy software carl zeiss imaging blue - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier

    Image Search Results